Prevalence of Plasmodium falciparum infection among pregnant women at first antenatal visit in post-Ebola Monrovia, Liberia

Malaria Journal, Volume 17, No. 1, Year 2018

Interpretation

Background: Disruption of malaria control strategies during the West African 2014-2016 Ebola epidemic led to an increase in malaria-attributable mortality. However, recent data on malaria infection in vulnerable groups, such as pregnant women, are lacking in this post-Ebola scenario. This cross-sectional study aimed to assess the prevalence of Plasmodium falciparum infection and of molecular markers of drug resistance among pregnant women attending antenatal care in Monrovia, capital of Liberia. Methods: From October 2016 to June 2017, all pregnant women attending their first antenatal care visit at the Saint Joseph’s Catholic Hospital, Monrovia, were invited to participate in the study. In addition to their routine antenatal care tests, capillary blood spotted onto filter papers were collected from all consenting participants to determine presence of P. falciparum by real-time quantitative PCR. Molecular markers of anti-malarial drug resistance were assessed through Sanger sequencing and quantitative PCR in specimens positive for P. falciparum analysis. Results: Of the 195 women participants, 24 (12.3%) were P. falciparum-positive by qPCR. Infected women tended to be more commonly primigravidae and younger than uninfected ones. Parasite densities were higher in primigravidae. Fever was more frequently detected among the infected women. No statistically significant association between P. falciparum infection and haemoglobin levels or insecticide-treated net use was found. While high prevalence of genetic polymorphisms associated with chloroquine and amodiaquine resistance were detected, no molecular markers of artemisinin resistance were observed. Conclusion: Plasmodium falciparum infections are expected to occur in at least one in every eight women attending first ANC at private clinics in Monrovia and outside the peak of the rainy season. Young primigravidae are at increased risk of P. falciparum infection. Molecular analyses did not provide evidence of resistance to artemisinins among the P. falciparum isolates tested. Further epidemiological studies involving pregnant women are necessary to describe the risk of malaria in this highly susceptible group outside Monrovia, as well as to closely monitor the emergence of resistance to anti-malarials, as recommended by the Liberian National Malaria Control Programme. This was an observational cross-sectional study that aimed to assess the burden of malaria among pregnant women attending ANC in Monrovia. Specific objectives of the study included determining the prevalence of P. falciparum infection in this particular vulnerable group through molecular assays, and assessing molecular markers of drug resistance in P. falciparum isolates. The study was conducted at the Outpatients Department (OPD) of the not-for-profit Saint Joseph’s Catholic Hospital (SJCH) in Congo Town neighbourhood, Monrovia. The SJCH was founded in 1963 by the Hospitaller Order of the Brothers of St John of God. In 2014, the SJCH closed for 4 months after nine of its staff members died to Ebola. Since its reopening in 2015, the SJCH provides general services to the population of Monrovia. Although the SJCH applies a cost recovery system for the general public, the institution has a charity arm to subsidize healthcare-related costs for the most deprived ones. Its official fee for a first ANC is of 5.00 USD. However, as the SJCH is supported by the National HIV and Malaria Programmes, diagnostics and therapeutics for HIV/AIDS and malaria are provided free-of-charge. Inclusion criteria set for sampling eligible participants at the OPD included: pregnant women of any gestational age attending ANC at the SJCH for the first time in their current pregnancy. Women unwilling to give consent to participate or who reported having received any IPTp dose during their current pregnancy were excluded. Calculations indicated that a sample of 198 women was needed to detect a prevalence of PCR-confirmed parasitaemia of 50% (conservative estimate) with a ± 5% precision and a confidence level of 95%. After an initial period of training to the SJCH staff, recruitment and specimen collection was done between October 2016 and June 2017. All women arriving at the OPD who met the inclusion criteria were invited to participate and informed of the study objectives and specimen collection procedures. After providing written informed consent, they were queried regarding basic socio-demographic and malaria prevention-related data (i.e. use of ITN the preceding night, or last time their house was sprayed indoor-residual insecticides). Participants were also asked to volunteer their HIV and tuberculosis status, if known. An infrared thermometer was used to measure forehead temperature. Gestational age was assessed by date of last menstrual period and by measurement of fundal height. All data were manually captured by the recruiting midwife using individual standardized case report forms. All participants were referred to the SJCH Laboratory for specimen collection. Results of routine tests done at the SJCH laboratory as part of standard ANC care for all pregnant women (i.e. HIV, haemoglobin and syphilis) were also captured in their case report forms. Haemoglobin level was obtained using point-of-care Hemocue Hb 301 (®Radiometer Group, Ängelholm, Sweden). HIV serostatus and syphilis screening were assessed using rapid tests SD Bioline HIV-1/2 3.0 (®Alere Inc., Waltham, MA) and SD Bioline HIV/Syphilis Duo (®Alere Inc., Waltham, MA), respectively. Capillary blood from the women’s fingers was collected on two Whatman 903 filter papers that were shipped to ISGlobal Laboratory (Barcelona, Spain) for molecular testing. The presence of P. falciparum was determined by real-time Quantitative PCR (qPCR). Briefly, DNA extracted by Chelex method from the filter paper was used for detection of 18S rRNA in duplicate [40, 41]. Parasite density was quantified by extrapolation of cycle thresholds (Ct) from a standard curve of P. falciparum ring-infected erythrocytes. A negative control with no template DNA was run in all reactions. Samples that tested positive for P. falciparum were subjected for the analysis of molecular markers of anti-malarial drug resistance using previously described methods [42–44]. DNA from samples with less than 5 parasites/μL was subjected to pre-amplification using PicoPLEX WGA Kit (®Rubicon Genomics: Cat. No. —{“type”:”entrez-nucleotide”,”attrs”:{“text”:”R30050″,”term_id”:”936746″}}R30050) as per manufacturer’s instructions. DNA templates were then subjected to PCR amplification of molecular markers of k13, pfcrt, pfmdr1 and pfdhps genes using a 2720 thermal cycler (®Applied Biosystems) followed by direct DNA Sanger sequencing bi-directionally [44]. A set of primer pair (Fw: caaattctatagtgtagttc; Rv: aattgtgtgatttgtccacaa) was used to sequence pfdhps 522–646 amino acid positions. For pfpm2 and pfmdr1 genes, copy number (CN) was also determined by SYBR-based qPCR (2× Power SYBR Green PCT Master Mix; ®Thermo Fisher Scientific, Washington, WA, UK) [44, 45]. All samples with estimated CN > 1.5 were repeated for confirmation. Water and human genomic DNA were used as negative controls. A total of six positive controls with known k13 alleles; four parasite lines (3D7, 7G8, Dd2 and V1/S) with known pfcrt and pfmdr1 alleles; four plasmids (DHPS-V1S, DHPS-PERU, DHPS-MALI and DHPS-DD2) with known pfdhps alleles; one positive control (C4) with known copies (3–4) of pfpm2 gene; another positive control (Dd2) with known copies (3–4) of pfmdr1 were also processed, amplified and sequenced. Isolates with mixed alleles were considered as mutated for the purposes of polymorphism frequency estimation. A unique identification number was used to link signed consent forms to case report forms. Case report forms did not include personal identifiers and were used to collect socio-demographic, malaria care-related data, and ANC routine laboratory tests data. Data from the case report forms were digitized by a SJCH trained clerk into an online case record form manager built in open source software OpenClinica (®OpenClinica LLL., Waltham, MA) and kept safely in a locked cabinet at the SJCH. ISGlobal Laboratory data were directly captured by the laboratory technician into the OpenClinica-generated dataset. Access to OpenClinica was password protected. OpenClinica server is kept at the Hospital Clínic (Barcelona, Spain) server. All blood specimens collected were included in the qPCR analysis. A positive P. falciparum infection in peripheral blood by qPCR, irrespective of parasite density, was the primary outcome in the analysis presented in this paper. Fever was defined as temperature ≥ 38 °C, and maternal anaemia as haemoglobin levels < 11 mg/dL (being mild if between 10 and 10.9 mg/dL, moderate if between 7 and 9.9 mg/dL, and severe if < 7 mg/dL). Women were classified as primigravidae (first pregnancy) or multigravidae (at least one previous pregnancy). Cross tabulations and t-test, Pearson Chi squared test (χ2) or Fisher’s exact test were used, where appropriate, to explore whether socio-demographics and other health-related variables of interest were associated with P. falciparum infection. Data analysis was conducted using STATA v.12.0 (®StataCorp LLD., College Station, Texas, USA). Significance level was set at p < 0.05. The study was conducted in accordance with the ICH E6 Good Clinical Practice [46], and under the provisions of the Declaration of Helsinki [47], and local rules and regulations. Written informed consent was sought for all women if 18 years of age or older. Parental consent in addition to minor assent was sought for all women aged younger than 18 years. Participants did not receive any retribution for their engagement as study subjects. Refusal to participate in this study did not affect service provision as per standard ANC practice. All women invited to enrol in this study, both consenting and non-consenting, received their first dosage of IPTp and treatment for anaemia, if necessary. This research protocol was approved by the local University of Liberia-Pacific Institute Research and Evaluation Institutional Review Board (UL-PIRE, Monrovia, Liberia) and by the Hospital Clínic Health Research Ethics Committee (CEIC, Barcelona, Spain).

AI Digest

Study Justification:

The study aimed to assess the prevalence of Plasmodium falciparum infection and molecular markers of drug resistance among pregnant women attending antenatal care in Monrovia, Liberia. This was important because during the Ebola epidemic, malaria control strategies were disrupted, leading to an increase in malaria-attributable mortality. However, there was a lack of recent data on malaria infection in vulnerable groups, such as pregnant women, in the post-Ebola scenario.

Highlights:

– The study found that 12.3% of the pregnant women tested positive for P. falciparum infection.
– Infected women were more commonly primigravidae (first pregnancy) and younger than uninfected women.
– Parasite densities were higher in primigravidae, and fever was more frequently detected among infected women.
– No statistically significant association was found between P. falciparum infection and haemoglobin levels or insecticide-treated net use.
– The study did not find evidence of resistance to artemisinins among the P. falciparum isolates tested.

Recommendations for Lay Reader:

– Pregnant women attending their first antenatal care visit in Monrovia have a high risk of P. falciparum infection.
– Young primigravidae are particularly vulnerable to malaria.
– It is important to continue monitoring the emergence of resistance to anti-malarial drugs.
– Further studies are needed to understand the risk of malaria in pregnant women outside of Monrovia.

Recommendations for Policy Maker:

– Strengthen malaria control strategies for pregnant women attending antenatal care in Monrovia.
– Focus on providing targeted interventions for young primigravidae.
– Invest in surveillance systems to closely monitor the emergence of drug resistance.
– Support further epidemiological studies to assess the risk of malaria in pregnant women outside of Monrovia.

Key Role Players:

– Researchers and scientists involved in malaria control and epidemiology.
– Healthcare providers and midwives working in antenatal care clinics.
– National Malaria Control Programme in Liberia.
– Local and international NGOs working on malaria prevention and control.

Cost Items for Planning Recommendations:

– Training and capacity building for healthcare staff on malaria prevention and control.
– Procurement and distribution of insecticide-treated nets.
– Diagnostic tests and treatment for malaria.
– Surveillance systems for monitoring drug resistance.
– Research funding for further epidemiological studies.

Strength of Evidence

The strength of evidence for this abstract is 7 out of 10.
The evidence in the abstract is moderately strong. The study design was observational and cross-sectional, which limits the ability to establish causality. However, the study had a clear objective and methodology, including molecular assays to determine the prevalence of P. falciparum infection and assess molecular markers of drug resistance. The study sample size was calculated to achieve a desired level of precision. To improve the strength of the evidence, future studies could consider using a longitudinal design to establish temporal relationships and conduct randomized controlled trials to assess the effectiveness of interventions. Additionally, the abstract could provide more information on the representativeness of the study sample and the generalizability of the findings to other populations.

Abstract

This was an observational cross-sectional study that aimed to assess the burden of malaria among pregnant women attending ANC in Monrovia. Specific objectives of the study included determining the prevalence of P. falciparum infection in this particular vulnerable group through molecular assays, and assessing molecular markers of drug resistance in P. falciparum isolates. The study was conducted at the Outpatients Department (OPD) of the not-for-profit Saint Joseph’s Catholic Hospital (SJCH) in Congo Town neighbourhood, Monrovia. The SJCH was founded in 1963 by the Hospitaller Order of the Brothers of St John of God. In 2014, the SJCH closed for 4 months after nine of its staff members died to Ebola. Since its reopening in 2015, the SJCH provides general services to the population of Monrovia. Although the SJCH applies a cost recovery system for the general public, the institution has a charity arm to subsidize healthcare-related costs for the most deprived ones. Its official fee for a first ANC is of 5.00 USD. However, as the SJCH is supported by the National HIV and Malaria Programmes, diagnostics and therapeutics for HIV/AIDS and malaria are provided free-of-charge. Inclusion criteria set for sampling eligible participants at the OPD included: pregnant women of any gestational age attending ANC at the SJCH for the first time in their current pregnancy. Women unwilling to give consent to participate or who reported having received any IPTp dose during their current pregnancy were excluded. Calculations indicated that a sample of 198 women was needed to detect a prevalence of PCR-confirmed parasitaemia of 50% (conservative estimate) with a ± 5% precision and a confidence level of 95%. After an initial period of training to the SJCH staff, recruitment and specimen collection was done between October 2016 and June 2017. All women arriving at the OPD who met the inclusion criteria were invited to participate and informed of the study objectives and specimen collection procedures. After providing written informed consent, they were queried regarding basic socio-demographic and malaria prevention-related data (i.e. use of ITN the preceding night, or last time their house was sprayed indoor-residual insecticides). Participants were also asked to volunteer their HIV and tuberculosis status, if known. An infrared thermometer was used to measure forehead temperature. Gestational age was assessed by date of last menstrual period and by measurement of fundal height. All data were manually captured by the recruiting midwife using individual standardized case report forms. All participants were referred to the SJCH Laboratory for specimen collection. Results of routine tests done at the SJCH laboratory as part of standard ANC care for all pregnant women (i.e. HIV, haemoglobin and syphilis) were also captured in their case report forms. Haemoglobin level was obtained using point-of-care Hemocue Hb 301 (®Radiometer Group, Ängelholm, Sweden). HIV serostatus and syphilis screening were assessed using rapid tests SD Bioline HIV-1/2 3.0 (®Alere Inc., Waltham, MA) and SD Bioline HIV/Syphilis Duo (®Alere Inc., Waltham, MA), respectively. Capillary blood from the women’s fingers was collected on two Whatman 903 filter papers that were shipped to ISGlobal Laboratory (Barcelona, Spain) for molecular testing. The presence of P. falciparum was determined by real-time Quantitative PCR (qPCR). Briefly, DNA extracted by Chelex method from the filter paper was used for detection of 18S rRNA in duplicate [40, 41]. Parasite density was quantified by extrapolation of cycle thresholds (Ct) from a standard curve of P. falciparum ring-infected erythrocytes. A negative control with no template DNA was run in all reactions. Samples that tested positive for P. falciparum were subjected for the analysis of molecular markers of anti-malarial drug resistance using previously described methods [42–44]. DNA from samples with less than 5 parasites/μL was subjected to pre-amplification using PicoPLEX WGA Kit (®Rubicon Genomics: Cat. No. —{“type”:”entrez-nucleotide”,”attrs”:{“text”:”R30050″,”term_id”:”936746″}}R30050) as per manufacturer’s instructions. DNA templates were then subjected to PCR amplification of molecular markers of k13, pfcrt, pfmdr1 and pfdhps genes using a 2720 thermal cycler (®Applied Biosystems) followed by direct DNA Sanger sequencing bi-directionally [44]. A set of primer pair (Fw: caaattctatagtgtagttc; Rv: aattgtgtgatttgtccacaa) was used to sequence pfdhps 522–646 amino acid positions. For pfpm2 and pfmdr1 genes, copy number (CN) was also determined by SYBR-based qPCR (2× Power SYBR Green PCT Master Mix; ®Thermo Fisher Scientific, Washington, WA, UK) [44, 45]. All samples with estimated CN > 1.5 were repeated for confirmation. Water and human genomic DNA were used as negative controls. A total of six positive controls with known k13 alleles; four parasite lines (3D7, 7G8, Dd2 and V1/S) with known pfcrt and pfmdr1 alleles; four plasmids (DHPS-V1S, DHPS-PERU, DHPS-MALI and DHPS-DD2) with known pfdhps alleles; one positive control (C4) with known copies (3–4) of pfpm2 gene; another positive control (Dd2) with known copies (3–4) of pfmdr1 were also processed, amplified and sequenced. Isolates with mixed alleles were considered as mutated for the purposes of polymorphism frequency estimation. A unique identification number was used to link signed consent forms to case report forms. Case report forms did not include personal identifiers and were used to collect socio-demographic, malaria care-related data, and ANC routine laboratory tests data. Data from the case report forms were digitized by a SJCH trained clerk into an online case record form manager built in open source software OpenClinica (®OpenClinica LLL., Waltham, MA) and kept safely in a locked cabinet at the SJCH. ISGlobal Laboratory data were directly captured by the laboratory technician into the OpenClinica-generated dataset. Access to OpenClinica was password protected. OpenClinica server is kept at the Hospital Clínic (Barcelona, Spain) server. All blood specimens collected were included in the qPCR analysis. A positive P. falciparum infection in peripheral blood by qPCR, irrespective of parasite density, was the primary outcome in the analysis presented in this paper. Fever was defined as temperature ≥ 38 °C, and maternal anaemia as haemoglobin levels < 11 mg/dL (being mild if between 10 and 10.9 mg/dL, moderate if between 7 and 9.9 mg/dL, and severe if < 7 mg/dL). Women were classified as primigravidae (first pregnancy) or multigravidae (at least one previous pregnancy). Cross tabulations and t-test, Pearson Chi squared test (χ2) or Fisher’s exact test were used, where appropriate, to explore whether socio-demographics and other health-related variables of interest were associated with P. falciparum infection. Data analysis was conducted using STATA v.12.0 (®StataCorp LLD., College Station, Texas, USA). Significance level was set at p < 0.05. The study was conducted in accordance with the ICH E6 Good Clinical Practice [46], and under the provisions of the Declaration of Helsinki [47], and local rules and regulations. Written informed consent was sought for all women if 18 years of age or older. Parental consent in addition to minor assent was sought for all women aged younger than 18 years. Participants did not receive any retribution for their engagement as study subjects. Refusal to participate in this study did not affect service provision as per standard ANC practice. All women invited to enrol in this study, both consenting and non-consenting, received their first dosage of IPTp and treatment for anaemia, if necessary. This research protocol was approved by the local University of Liberia-Pacific Institute Research and Evaluation Institutional Review Board (UL-PIRE, Monrovia, Liberia) and by the Hospital Clínic Health Research Ethics Committee (CEIC, Barcelona, Spain).

Materials

N/A

Innovations

The study described is focused on assessing the burden of malaria among pregnant women attending antenatal care (ANC) in Monrovia, Liberia. The specific objectives of the study include determining the prevalence of Plasmodium falciparum infection in pregnant women through molecular assays and assessing molecular markers of drug resistance in P. falciparum isolates. The study was conducted at the Saint Joseph’s Catholic Hospital in Monrovia, which provides general services to the population and offers subsidized healthcare for the most deprived individuals. The study collected data through interviews, physical examinations, and laboratory tests, including real-time quantitative PCR for detecting P. falciparum and Sanger sequencing for assessing molecular markers of drug resistance. The results showed a prevalence of P. falciparum infection in approximately 12.3% of the women participants. Young primigravidae were found to be at increased risk of infection. The study did not find evidence of resistance to artemisinins among the P. falciparum isolates tested. The researchers recommend further epidemiological studies involving pregnant women to better understand the risk of malaria in this vulnerable group and to monitor the emergence of drug resistance. The study was conducted in accordance with ethical guidelines and obtained approval from the local research ethics committees.

AI Innovations Description

The study described is focused on assessing the burden of malaria among pregnant women attending antenatal care (ANC) in Monrovia, Liberia, in the post-Ebola scenario. The specific objectives of the study were to determine the prevalence of Plasmodium falciparum infection and molecular markers of drug resistance among pregnant women attending their first ANC visit at the Saint Joseph’s Catholic Hospital in Monrovia.

The study was conducted between October 2016 and June 2017. A total of 195 pregnant women were included in the study. Capillary blood samples were collected from all participants to detect the presence of P. falciparum using real-time quantitative PCR (qPCR). Molecular markers of anti-malarial drug resistance were also assessed through Sanger sequencing and qPCR in P. falciparum-positive samples.

The results of the study showed that 12.3% of the women were P. falciparum-positive by qPCR. Infected women were more commonly primigravidae (first pregnancy) and younger than uninfected women. Parasite densities were higher in primigravidae, and fever was more frequently detected among infected women. No statistically significant association was found between P. falciparum infection and haemoglobin levels or insecticide-treated net use. The study did not find evidence of resistance to artemisinins among the P. falciparum isolates tested.

The study concluded that P. falciparum infections are expected to occur in at least one in every eight women attending their first ANC visit at private clinics in Monrovia. Young primigravidae are at an increased risk of P. falciparum infection. Further epidemiological studies involving pregnant women are necessary to describe the risk of malaria in this highly susceptible group outside Monrovia and to monitor the emergence of resistance to anti-malarials.

Based on the findings of this study, a recommendation to improve access to maternal health and address the burden of malaria among pregnant women could be to strengthen malaria prevention and control strategies in ANC settings. This could include:

1. Providing comprehensive malaria prevention interventions, such as insecticide-treated bed nets and intermittent preventive treatment for malaria in pregnancy (IPTp), to all pregnant women attending ANC.
2. Conducting regular malaria screening and testing for pregnant women during ANC visits to ensure early detection and prompt treatment of infections.
3. Implementing targeted interventions for primigravidae and younger pregnant women, who are at higher risk of P. falciparum infection.
4. Enhancing health education and awareness programs for pregnant women and healthcare providers on the importance of malaria prevention and control measures.
5. Strengthening the capacity of healthcare facilities to diagnose and treat malaria in pregnant women, including ensuring the availability of effective anti-malarial drugs and trained healthcare personnel.
6. Collaborating with national malaria control programs and other relevant stakeholders to develop and implement evidence-based policies and guidelines for malaria prevention and control in ANC settings.

By implementing these recommendations, it is expected that access to maternal health will be improved, and the burden of malaria among pregnant women in Monrovia and similar settings will be reduced.

AI Innovations Methodology

The study described is focused on assessing the prevalence of Plasmodium falciparum infection and molecular markers of drug resistance among pregnant women attending antenatal care in Monrovia, Liberia, in the post-Ebola scenario. The methodology used in this study includes the following steps:

1. Study Setting: The study was conducted at the Outpatients Department (OPD) of the Saint Joseph’s Catholic Hospital (SJCH) in Monrovia, Liberia. The SJCH provides general services to the population and offers subsidized healthcare for the most deprived individuals.

2. Sample Selection: All pregnant women attending their first antenatal care visit at the SJCH between October 2016 and June 2017 were invited to participate in the study. Inclusion criteria included being a pregnant woman attending ANC for the first time in their current pregnancy, while exclusion criteria included unwillingness to participate or having received any IPTp dose during the current pregnancy.

3. Data Collection: After obtaining written informed consent, participants were interviewed to collect socio-demographic and malaria prevention-related data. Routine tests for HIV, hemoglobin, and syphilis were conducted as part of standard ANC care. Capillary blood samples were collected on filter papers for molecular testing.

4. Laboratory Analysis: The presence of P. falciparum was determined using real-time quantitative PCR (qPCR) on the filter paper samples. Parasite density was quantified, and molecular markers of anti-malarial drug resistance were assessed through Sanger sequencing and quantitative PCR.

5. Data Analysis: Cross tabulations, t-tests, Pearson Chi-squared tests, and Fisher’s exact tests were used to explore associations between socio-demographic and health-related variables with P. falciparum infection. Data analysis was conducted using STATA software.

6. Ethical Considerations: The study was conducted in accordance with Good Clinical Practice guidelines and the Declaration of Helsinki. Written informed consent was obtained from participants, and ethical approval was obtained from the local University of Liberia-Pacific Institute Research and Evaluation Institutional Review Board and the Hospital Clínic Health Research Ethics Committee.

To improve access to maternal health, potential recommendations based on the findings of this study could include:

1. Strengthening Malaria Control Strategies: Given the prevalence of P. falciparum infection among pregnant women, it is important to enhance malaria control strategies, such as the distribution of insecticide-treated nets and the provision of intermittent preventive treatment for pregnant women (IPTp).

2. Targeted Interventions for Vulnerable Groups: Since young primigravidae were found to be at increased risk of P. falciparum infection, targeted interventions should be implemented to provide additional support and resources for this group.

3. Monitoring Drug Resistance: As no molecular markers of artemisinin resistance were observed in this study, it is crucial to continue monitoring drug resistance patterns to ensure effective treatment of malaria in pregnant women.

4. Expansion of ANC Services: To improve access to maternal health, efforts should be made to expand ANC services, particularly in areas outside of Monrovia, to reach pregnant women in remote or underserved areas.

To simulate the impact of these recommendations on improving access to maternal health, a methodology could involve:

1. Data Collection: Collect data on the current access to maternal health services, including ANC attendance rates, availability of malaria control interventions, and prevalence of P. falciparum infection among pregnant women.

2. Modeling: Develop a mathematical model that incorporates the collected data and simulates the impact of the recommended interventions on access to maternal health. The model should consider factors such as population demographics, geographical distribution, and the effectiveness of the interventions.

3. Scenario Analysis: Use the model to simulate different scenarios, such as scaling up the distribution of insecticide-treated nets, increasing the coverage of IPTp, or expanding ANC services to remote areas. Assess the impact of each scenario on improving access to maternal health, including reductions in P. falciparum infection rates and improvements in ANC attendance.

4. Evaluation: Evaluate the simulated impact of the different scenarios and compare the outcomes to identify the most effective interventions for improving access to maternal health. Consider factors such as cost-effectiveness, feasibility, and sustainability.

5. Policy Recommendations: Based on the evaluation results, provide policy recommendations to stakeholders, including government agencies, healthcare providers, and international organizations, to guide the implementation of interventions that will have the greatest impact on improving access to maternal health.

By following this methodology, policymakers and healthcare providers can make informed decisions on implementing interventions that will effectively improve access to maternal health and reduce the burden of malaria among pregnant women.

Author

Dima Health

Statistics:

Citations: 9

Identifiers:

DOI: 10.1186/s12936-018-2506-z

Research Areas:

Cancer, Community Interventions, Environmental, Genetics and Genomics, Health System and Policy, Infectious Diseases, Maternal Access, Maternal and Child Health, Quality of Care, Sexual and Reproductive Health, Social Determinants

Study Countries:

Congo, Liberia, Mali, Multi-Countries

Study Design:

Cross Sectional Study

Study Approach:

Quantitative

Participants Gender:

Female